View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7117_low_26 (Length: 258)

Name: NF7117_low_26
Description: NF7117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7117_low_26
NF7117_low_26
[»] chr4 (1 HSPs)
chr4 (1-243)||(7305229-7305471)
[»] chr1 (1 HSPs)
chr1 (103-198)||(14126932-14127027)


Alignment Details
Target: chr4 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 7305471 - 7305229
Alignment:
1 ctacttatgtcgtgagtaccttcttgctacctaacaccctgataaaggaaattgaaaaatatgttaaatgcattctcgtggggacacggtaatggtggta 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
7305471 ctacttatgtcgtgagtaccttcttgctacctaacaccctgataaaggaaattgaaaaatatgttaaatgcattctagtggggacacggtaatggtggta 7305372  T
101 atagaggtatgcactggctatcttgggaatgcctcactgttccaaaaggcttcggtggcatgggtttcaaaagtctcaaggctttcaacatggcaatgat 200  Q
    |||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7305371 atagaggtatgcaccggctatcttgtgaatgcctcactgttccaaaaggcttcggtggcatgggtttcaaaagtctcaaggctttcaacatggcaatgat 7305272  T
201 gggcaaactggcttggatgttgctcaataacccagactctctg 243  Q
    |||||||||||| ||||||||||||||||||||||||||||||    
7305271 gggcaaactggcgtggatgttgctcaataacccagactctctg 7305229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 103 - 198
Target Start/End: Original strand, 14126932 - 14127027
Alignment:
103 agaggtatgcactggctatcttgggaatgcctcactgttccaaaaggcttcggtggcatgggtttcaaaagtctcaaggctttcaacatggcaatg 198  Q
    ||||||||||| ||| | || |||||  | ||||  ||| ||||||| ||||| ||||||||||||||||||||||| || || || |||||||||    
14126932 agaggtatgcattggttgtcgtgggagcgactcagagttgcaaaagggttcggaggcatgggtttcaaaagtctcaaagcctttaatatggcaatg 14127027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University