View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7117_low_26 (Length: 258)
Name: NF7117_low_26
Description: NF7117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7117_low_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 7305471 - 7305229
Alignment:
| Q |
1 |
ctacttatgtcgtgagtaccttcttgctacctaacaccctgataaaggaaattgaaaaatatgttaaatgcattctcgtggggacacggtaatggtggta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7305471 |
ctacttatgtcgtgagtaccttcttgctacctaacaccctgataaaggaaattgaaaaatatgttaaatgcattctagtggggacacggtaatggtggta |
7305372 |
T |
 |
| Q |
101 |
atagaggtatgcactggctatcttgggaatgcctcactgttccaaaaggcttcggtggcatgggtttcaaaagtctcaaggctttcaacatggcaatgat |
200 |
Q |
| |
|
|||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7305371 |
atagaggtatgcaccggctatcttgtgaatgcctcactgttccaaaaggcttcggtggcatgggtttcaaaagtctcaaggctttcaacatggcaatgat |
7305272 |
T |
 |
| Q |
201 |
gggcaaactggcttggatgttgctcaataacccagactctctg |
243 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
7305271 |
gggcaaactggcgtggatgttgctcaataacccagactctctg |
7305229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 103 - 198
Target Start/End: Original strand, 14126932 - 14127027
Alignment:
| Q |
103 |
agaggtatgcactggctatcttgggaatgcctcactgttccaaaaggcttcggtggcatgggtttcaaaagtctcaaggctttcaacatggcaatg |
198 |
Q |
| |
|
||||||||||| ||| | || ||||| | |||| ||| ||||||| ||||| ||||||||||||||||||||||| || || || ||||||||| |
|
|
| T |
14126932 |
agaggtatgcattggttgtcgtgggagcgactcagagttgcaaaagggttcggaggcatgggtttcaaaagtctcaaagcctttaatatggcaatg |
14127027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University