View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7117_low_3 (Length: 470)
Name: NF7117_low_3
Description: NF7117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7117_low_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 240; Significance: 1e-133; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 130 - 402
Target Start/End: Original strand, 17236450 - 17236721
Alignment:
| Q |
130 |
gatggtgtctttggtaaaagatgttatatatggtttgttgtttgtaaagatgttatatgttgccaggttttaattagtttagtgttattgaaatactgat |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17236450 |
gatggtgtctttggtaaaagatgttatatatggtttgttgtttgtaaagatgttatatgttgccaggttttaattagtttagtgttattgaaatactgat |
17236549 |
T |
 |
| Q |
230 |
tatgattcattatatcattcaattagttggttttgttttagtcaaaatttacttgagttatttcattcatcgttgttcacatccaaaacaaattttaaga |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
17236550 |
tatgattcattatatcattcaattagttggttttgttttagtgaaaatttacttgagttatttcattcatcgttgttcacatccaaaacaaa-tttaaga |
17236648 |
T |
 |
| Q |
330 |
gttaattgcnnnnnnncagtcaaatatacaagtgagttgaataaactcaactgaatagatgacgtagctgaat |
402 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17236649 |
gttaattgcaaaaaaacagtcaaatatacaagtgagttgaataaactcaactgaatagatgacgtagctgaat |
17236721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 73; E-Value: 4e-33
Query Start/End: Original strand, 1 - 77
Target Start/End: Original strand, 17236325 - 17236401
Alignment:
| Q |
1 |
ttttataaagaggtttaagcagcaacttaggttggaaaggcttgattctattttacgttatagagacatacttcatc |
77 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
17236325 |
ttttataaagaggtttaagcagcaacttaggttggaaaggcttgattctattttacgttatagagatatacttcatc |
17236401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University