View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7117_low_32 (Length: 250)
Name: NF7117_low_32
Description: NF7117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7117_low_32 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 9 - 250
Target Start/End: Complemental strand, 17472274 - 17472023
Alignment:
| Q |
9 |
agcaaaggccttgaaacctgattattgttcaaaaatacaaaacaaagttaagtactaaaacnnnnnnn-attattcaaaatctatgaagcatgacaaaca |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
17472274 |
agcaaaggccttgaaacctgattattgttcaaaaatacaaaacaaagttaagtactaaaactattatttattattcaaaatctatgaagcatgacaaaca |
17472175 |
T |
|
| Q |
108 |
ttgaatatcaaacacaactcttaataatttgagaaaataaatg----------taatcaaatatgttagtttcatgttacatttatcggacatgagacac |
197 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||| |||||||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
17472174 |
ttgaatatcaaacacaactcataataatttgagaaaataaatgtaattaaatgtaatcaaatatgttggtttcatgttatatttatcggacatgagacac |
17472075 |
T |
|
| Q |
198 |
actttcaaccaaagatgttgtgcttgatgcctgatttaatattacttccgttc |
250 |
Q |
| |
|
||||||||||| ||||||||| | ||||||| | ||||||| ||||||||||| |
|
|
| T |
17472074 |
actttcaaccagagatgttgtacatgatgccag-tttaatactacttccgttc |
17472023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University