View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7117_low_40 (Length: 240)
Name: NF7117_low_40
Description: NF7117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7117_low_40 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 18 - 240
Target Start/End: Original strand, 18959538 - 18959757
Alignment:
| Q |
18 |
ggtaggagcttaattcacttgtatgcttagtgcaaaatatttgactgtgtaatactatcaacacattttcttcttgtcaaataatctagtgacgagaatc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18959538 |
ggtaggagcttaattcacttgtatgcttagtacaaaatatttgactgtgtaatactatcaacacattttcttcttgtcaaataatctagtgacgagaatc |
18959637 |
T |
|
| Q |
118 |
tcgcacagtaaaaaattgtaaattcgaacttccgtccgaacacaacaaatgtctttagagctatcatatgaagaagagtgcatacaaggtcaatacaatt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
18959638 |
tcgcacagtaaaaaattgtaaattcgaacttccgtccgaacacaacaaatgtctttagagctatcatat---gaagagtgcatacaaggtcaatacaatt |
18959734 |
T |
|
| Q |
218 |
ttatatgcaaaagtatttgagat |
240 |
Q |
| |
|
|| ||||||||||||||| |||| |
|
|
| T |
18959735 |
ttgtatgcaaaagtatttaagat |
18959757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University