View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7117_low_45 (Length: 236)
Name: NF7117_low_45
Description: NF7117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7117_low_45 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 1 - 204
Target Start/End: Original strand, 7305662 - 7305866
Alignment:
| Q |
1 |
ttagctattattttttctttacataacgaaaaacgattttaattcgtacacattgttatcataaattttatatgagataagatccatt---gacactatc |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
7305662 |
ttagctattattttttctttacataacgaaaaacgattttaattcatacacattgttatcataaattttat--gagataagatccattattgacactatc |
7305759 |
T |
 |
| Q |
98 |
tctcaaaaatatccattgacaagtgtaatttttgacttaaaccaaatttcaatcattaaaccacatcacatattgtatcgggatgccgttgctttaccaa |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7305760 |
tctcaaaaatatccattgacaagtgtaatttttgacttaaaccaaatttcaatcatttaaccacatcacatattgtatcgggatgccgttgctttaccaa |
7305859 |
T |
 |
| Q |
198 |
gctaggc |
204 |
Q |
| |
|
||||||| |
|
|
| T |
7305860 |
gctaggc |
7305866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University