View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7117_low_46 (Length: 234)
Name: NF7117_low_46
Description: NF7117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7117_low_46 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 30 - 218
Target Start/End: Complemental strand, 37555917 - 37555729
Alignment:
| Q |
30 |
tgtaaaagatatcaggatttgattcaccaacttcaagtacccatttaggtaatggaatggaaacagaatctccaatattccctccacattgatgaaatga |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37555917 |
tgtaaaagatatcaggatttgattcaccaacttcaagtacccatttaggtaatggaatggaaacagaatctccaatattccctccacattgatgaaatga |
37555818 |
T |
|
| Q |
130 |
cattatagcttgtaacttaagtttgcaatcctgaacaagctgaaacaaggacctataagctgaccaatcatactgctgaggaccctttg |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37555817 |
cattatagcttgtaacttaagtttgcaatcctgaacaagctgaaacaaggacctataagctgaccaatcatactgctgaggaccctttg |
37555729 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 30 - 141
Target Start/End: Complemental strand, 15502654 - 15502543
Alignment:
| Q |
30 |
tgtaaaagatatcaggatttgattcaccaacttcaagtacccatttaggtaatggaatggaaacagaatctccaatattccctccacattgatgaaatga |
129 |
Q |
| |
|
|||| ||||||||||||| |||||| |||| |||||||||||||| || ||||| ||| |||| ||| || | ||| |||||||||||||| ||||| |
|
|
| T |
15502654 |
tgtagaagatatcaggatctgattctccaatgtcaagtacccattttggcaatgggatgttaacaacatcacctacatttcctccacattgatggaatga |
15502555 |
T |
|
| Q |
130 |
cattatagcttg |
141 |
Q |
| |
|
||| |||||||| |
|
|
| T |
15502554 |
catgatagcttg |
15502543 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University