View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7117_low_48 (Length: 227)
Name: NF7117_low_48
Description: NF7117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7117_low_48 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 38392757 - 38392976
Alignment:
| Q |
1 |
tattttcttgtcatttagtaaatgaaccaaataatattgatagtggcttccgattcatatttcacctcatccgcgtgctgtcattatttgctctctatct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||| |||||||||||||||| ||| ||||||| |
|
|
| T |
38392757 |
tattttcttgtcatttagtaaatgaaccaaataatattgatagtggcttccgattcatattccagctcatgcgcgtgctgtcattatctgcattctatct |
38392856 |
T |
|
| Q |
101 |
tttgtctctctctaatttgctttttctggatttatgtctcagacttcgttttttattcacttgtgtctctaatctgcttatccgtctcggtcgctgattt |
200 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38392857 |
tttgtctctcactaattttctttttctggatttatgtctcagacttcgttttttattcacttgtgtctctaatctgcttatccgtctcggtcgctgattt |
38392956 |
T |
|
| Q |
201 |
gcagtttcgttcctatgctt |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
38392957 |
gcagtttcgttcctatgctt |
38392976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University