View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7118_high_18 (Length: 255)

Name: NF7118_high_18
Description: NF7118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7118_high_18
NF7118_high_18
[»] chr7 (2 HSPs)
chr7 (1-46)||(27729937-27729982)
chr7 (198-241)||(27729792-27729835)


Alignment Details
Target: chr7 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 27729982 - 27729937
Alignment:
1 ataattgaatttacacatttttagttttgttaaactatggattgga 46  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
27729982 ataattgaatttacacatttttagttttgttaaactatggattgga 27729937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 198 - 241
Target Start/End: Complemental strand, 27729835 - 27729792
Alignment:
198 gaattaagagtatttttgtctttcctttttcttcctatattgtt 241  Q
    |||||||||||||||||||||||||||||||||||||| |||||    
27729835 gaattaagagtatttttgtctttcctttttcttcctattttgtt 27729792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University