View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7118_high_20 (Length: 250)
Name: NF7118_high_20
Description: NF7118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7118_high_20 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 13 - 250
Target Start/End: Complemental strand, 18960161 - 18959918
Alignment:
| Q |
13 |
aatatacgaggggcataccggagatgaaacatggtttatat---nnnnnnnnctcagtggttcaattaggtaaa----atgtaatgccatatctcaacag |
105 |
Q |
| |
|
||||||||||||||| |||||||||| |||||||||||||| | ||||||||| |||||||||| ||||| | ||||||||||||| |
|
|
| T |
18960161 |
aatatacgaggggcaaaccggagatg-aacatggtttatataaaaaaaaactcacagtggttccattaggtaaacacggtgtaaggacatatctcaacag |
18960063 |
T |
 |
| Q |
106 |
gctgtagatattgtcttagaatatgtagttagacctaacatggcaatataggagggacaaattgaagatgaaacacggtttttcgaaattttttctcatc |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||| || |||||||||||||| |||||||||||||||||| |
|
|
| T |
18960062 |
gctgtagatattgtcttagaatatgtagttaggcctaacatggcaatataggaggggcaaatcaaaaatgaaacacggtttgtcgaaattttttctcatc |
18959963 |
T |
 |
| Q |
206 |
ggagggcagtgggtccatttggtaaacacgtgtaagattgtttct |
250 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
18959962 |
ggaggacagtgggtccacttggtaaacacgtgtaagattgtttct |
18959918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University