View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7118_high_23 (Length: 246)
Name: NF7118_high_23
Description: NF7118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7118_high_23 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 362171 - 361941
Alignment:
| Q |
1 |
caacactcacaacctaccattgctatatatacatatgtatatccatagagaactatcacttccaaatctcttacagtagaattatcactataattcagta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
362171 |
caacactcacaacctaccattgctatatatacatatgtatatccatagagaactatcacttccaaatctcttacagtagaattatcactataattcagta |
362072 |
T |
 |
| Q |
101 |
tggtactattggtaatgttaatcgatcaatatctttacaattcactactactttcaattattcaatcatgtgtacatgtgtgattaactttaatttgtgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
362071 |
tggtactattggtaatgttaatcgatcaatatctttacaattcactactactttcaattattcaatcatgtgtacatgtgtgattaactttaatttgtgg |
361972 |
T |
 |
| Q |
201 |
gcgtgttcgctaattcaggagcagaatattg |
231 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |
|
|
| T |
361971 |
gcgtgttcgttaattcaggagcagaatattg |
361941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University