View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7118_high_25 (Length: 243)
Name: NF7118_high_25
Description: NF7118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7118_high_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 121; Significance: 4e-62; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 107 - 231
Target Start/End: Original strand, 45666677 - 45666801
Alignment:
| Q |
107 |
cctttagcatcctcaatgcatctaatgggagatggattggtccacaattgtaagtttgcaaccaagaatactgttgatatgacgcatttagcttttttgc |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
45666677 |
cctttagcatcctcaatgcatctaatgggagatggattggtccacaattgtaagtttgcaaccaagagtactgttgatatgacgcatttagcttttttgc |
45666776 |
T |
 |
| Q |
207 |
tttaaaaatgtcaatgacgtgtgtg |
231 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
45666777 |
tttaaaaatgtcaatgacgtgtgtg |
45666801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 45666585 - 45666633
Alignment:
| Q |
1 |
ttttcatatgacggtttaatatcctaccaaatgctccacgcagaatgca |
49 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45666585 |
ttttcatatgacggtttaatatcctaccaaatgctccacgcagaatgca |
45666633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University