View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7118_high_28 (Length: 238)
Name: NF7118_high_28
Description: NF7118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7118_high_28 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 6691722 - 6691501
Alignment:
| Q |
1 |
tgtggtttttctaaaccaggatgcagcttccctctccgttgcaattttgaagaaaaaatttcgtggacgaattttcttgggttgtgacaatcatcctttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6691722 |
tgtggtttttctaaaccaggatgcagcttccctctccgttgcaattttgaagaaaaaatttcgtggacgaattttcttgggttgtgacaatcatcctttg |
6691623 |
T |
 |
| Q |
101 |
tccaggttagatgatttctcataagttttgaagtattatgatggagaccagaattggttcttcctttttgaaatttattccttactctagctatcaccat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
6691622 |
tccaggttagatgatttctcataagttttgaagtattatgatggagaccagaattggttcttcctttttgaaatttattccttactctag-tatcaccat |
6691524 |
T |
 |
| Q |
201 |
acgtacatacgctgagtgaagat |
223 |
Q |
| |
|
|| ||||||||||||||||||| |
|
|
| T |
6691523 |
acaaacatacgctgagtgaagat |
6691501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 15 - 110
Target Start/End: Complemental strand, 38874437 - 38874342
Alignment:
| Q |
15 |
accaggatgcagcttccctctccgttgcaattttgaagaaaaaatttcgtggacgaattttcttgggttgtgacaatcatcctttgtccaggttag |
110 |
Q |
| |
|
||||||||||||| ||||||| |||||||| |||||||||||| | ||| || |||||| |||||||||| ||||||||| |||| ||||||| |
|
|
| T |
38874437 |
accaggatgcagcctccctcttagttgcaatcttgaagaaaaaaatccgtaaacagattttcctgggttgtgataatcatcctctgtctaggttag |
38874342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University