View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7118_high_31 (Length: 227)
Name: NF7118_high_31
Description: NF7118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7118_high_31 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 17 - 209
Target Start/End: Original strand, 46467272 - 46467465
Alignment:
| Q |
17 |
aatatcggtgttccctaattgtgctaaaaaacaaattggagtataggaatatgttttataacatatggtgattgactgtgaaatagtttggtgctgattg |
116 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46467272 |
aatattggtgttccctaattgtgctaaaaaacaaattggagtataggaatatgttttataacatatggtgattgactgtgaaatagtttggtgctgattg |
46467371 |
T |
 |
| Q |
117 |
tactaaggagctgaatatggttggtggaatgaatctgatcatgtactggtgcgtgggacaagcgacatatggtctcca-tatgtggtgtctctg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
46467372 |
tactaaggagctgaatatggttggtggaatgaatctgatcatgtactggtgcgtgggacaagcgacatatggtctccattttgtggtgtctctg |
46467465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University