View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7118_high_6 (Length: 421)
Name: NF7118_high_6
Description: NF7118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7118_high_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 299; Significance: 1e-168; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 17 - 398
Target Start/End: Complemental strand, 12350771 - 12350406
Alignment:
| Q |
17 |
acacacgacgatggcggaagaagaggcatggttgagcgcatgagaactgcgcccacataggagtatagcaaccccaaacagggtgaaaagatagcgcgga |
116 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
12350771 |
acacacgacgatggcggaagaagaggcgtggttgagcgcatgagaactgcgcccacataagagtatagcaaccccaaacagggtgaaaagatagcgcaga |
12350672 |
T |
|
| Q |
117 |
ggggaccttgttgcaccatcactgctctagtctacatggttaagaaagaaattggattttgaaggggagaagtacggcaggtaaggaggaagagagaggt |
216 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12350671 |
ggggaccttgttgcaccatcgctgctctagtctacatggttaagaaagaaattggattttgaaggggagaagtacggcaggtaaggaggaagagagaggt |
12350572 |
T |
|
| Q |
217 |
cagaggatatggatttagagagattttttggatcatgattgcatgccttcccaagtattagtgtactatgtgcatattagagacgagaaatcattaatcc |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||| | || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12350571 |
cagaggatatggatttagagagattttttggatcatgatt-----cctcc----gt-------tactatgtgcatattagagacgagaaatcattaatcc |
12350488 |
T |
|
| Q |
317 |
tccattacccaatccaagtcaatcccttgaaatatacctagctagtgcgcctgtctcatgcatcaaactgctcagacgctta |
398 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12350487 |
tccattacccaatccaagtcaatcccttgaaatatacctagctagtgcgcctgtctcatgcatcaaactgctcagacgctta |
12350406 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University