View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7118_low_10 (Length: 397)
Name: NF7118_low_10
Description: NF7118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7118_low_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 165 - 380
Target Start/End: Complemental strand, 5933713 - 5933498
Alignment:
| Q |
165 |
ttaatcaaataaagaatcgaggctggtagtattaaatgttgcatgtgcatcaattaataaagactcttgtttgaactagtgtttctaattttgtcacaag |
264 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5933713 |
ttaaccaaataaagaatcgaggctggtagtattaaatgttgcatgtgcatcaattaatatagactcttgtttgaactagtgtttctaattttgtcacaag |
5933614 |
T |
|
| Q |
265 |
cattccaagtccctacatattacacgagctgctagatgcctggcacccttcttttttaactctaaagaatatgcattattccttttatttattagaaaat |
364 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5933613 |
cattccaagtccctacatattacaagagctgctagatgcctggcacccttgttttttaactctaaagaatatgcattattccttttatttattagaaaat |
5933514 |
T |
|
| Q |
365 |
actaacttgtgccctt |
380 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
5933513 |
actaacttgtgccctt |
5933498 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University