View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7118_low_17 (Length: 257)
Name: NF7118_low_17
Description: NF7118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7118_low_17 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 9 - 257
Target Start/End: Complemental strand, 6692079 - 6691831
Alignment:
| Q |
9 |
tcgagtttggtggttcggttgttagactgtctggactttatatatccttttcaaaaccacaatttgctacgatttcaaagttccattaatcttgtgtttg |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
6692079 |
tcgagtttggtggttcggttgttagactgtctggactttatatatccttttcaaaaccacaatttgctacgatttcaaagttccattaatcttgtatttg |
6691980 |
T |
 |
| Q |
109 |
gttatttctgttatgttcatagtggatgtcaaccttgacttttaatacaaagaaggtaaaggtgcacatgcttattatttagagaaggggatcgttgaat |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6691979 |
gttatttctgttatgttcatagtggatgtcaaccttgacttttaatacaaagaaggtaaaggtgcacatgcttattatttagagaaggggatcgttgaat |
6691880 |
T |
 |
| Q |
209 |
caagacctgatcatgtactgaatctcatacattatgaggttagaacttc |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6691879 |
caagacctgatcatgtactgaatctcatacattatgaggttagaacttc |
6691831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University