View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7118_low_18 (Length: 255)
Name: NF7118_low_18
Description: NF7118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7118_low_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 27729982 - 27729937
Alignment:
| Q |
1 |
ataattgaatttacacatttttagttttgttaaactatggattgga |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27729982 |
ataattgaatttacacatttttagttttgttaaactatggattgga |
27729937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 198 - 241
Target Start/End: Complemental strand, 27729835 - 27729792
Alignment:
| Q |
198 |
gaattaagagtatttttgtctttcctttttcttcctatattgtt |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
27729835 |
gaattaagagtatttttgtctttcctttttcttcctattttgtt |
27729792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University