View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7119_high_4 (Length: 248)
Name: NF7119_high_4
Description: NF7119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7119_high_4 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 126 - 248
Target Start/End: Complemental strand, 15884350 - 15884228
Alignment:
| Q |
126 |
tgctttgtgttgtttcgtcgtgctcctgattgcaagacctttggataattcgcatttgattttaacgtcgatttgcatttgaatgcaggtttatagtttg |
225 |
Q |
| |
|
|||||| | |||||||||| ||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||| ||||||||||| |
|
|
| T |
15884350 |
tgctttttattgtttcgtcatgctcctgattgcaagacctttggataattcacatttgattttaatgtcgatttgcatttgaatgcagctttatagtttg |
15884251 |
T |
 |
| Q |
226 |
ttacccatgtctaagaattgttt |
248 |
Q |
| |
|
|||||| |||||||||||||||| |
|
|
| T |
15884250 |
ttacccgtgtctaagaattgttt |
15884228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University