View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7119_low_4 (Length: 248)

Name: NF7119_low_4
Description: NF7119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7119_low_4
NF7119_low_4
[»] chr6 (1 HSPs)
chr6 (126-248)||(15884228-15884350)


Alignment Details
Target: chr6 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 126 - 248
Target Start/End: Complemental strand, 15884350 - 15884228
Alignment:
126 tgctttgtgttgtttcgtcgtgctcctgattgcaagacctttggataattcgcatttgattttaacgtcgatttgcatttgaatgcaggtttatagtttg 225  Q
    |||||| | |||||||||| ||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||| |||||||||||    
15884350 tgctttttattgtttcgtcatgctcctgattgcaagacctttggataattcacatttgattttaatgtcgatttgcatttgaatgcagctttatagtttg 15884251  T
226 ttacccatgtctaagaattgttt 248  Q
    |||||| ||||||||||||||||    
15884250 ttacccgtgtctaagaattgttt 15884228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University