View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7120_high_7 (Length: 293)
Name: NF7120_high_7
Description: NF7120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7120_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 167; Significance: 2e-89; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 73 - 279
Target Start/End: Original strand, 9945978 - 9946184
Alignment:
| Q |
73 |
tacagtcattgtcattgtcatcattgcatttggcggcattgccttgctctccatgcttgcttttgcattattttgctgcgttcaaaagaggaagaagaaa |
172 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9945978 |
tacagtcattgtcattgtcatcattgcatttggtggcattgccttgctctccatgcttgcttttgcattattttgctgcgttcaaaagaggaagaagaaa |
9946077 |
T |
 |
| Q |
173 |
caagaaaccgatatcgttcatatcaatgaacataaaaagatcacggaaaatattgtgcctggtcctaatggacaaccactggtggtggttacagttgaag |
272 |
Q |
| |
|
|||||||||||| || |||||||| |||||||||||||||| |||||||| ||||||||||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
9946078 |
caagaaaccgatgtcattcatatcgatgaacataaaaagattacggaaaacattgtgcctggtccttttggacaaccaacggtggtggttacagttgaag |
9946177 |
T |
 |
| Q |
273 |
atgatgt |
279 |
Q |
| |
|
||||||| |
|
|
| T |
9946178 |
atgatgt |
9946184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 163 - 248
Target Start/End: Complemental strand, 1022214 - 1022129
Alignment:
| Q |
163 |
gaagaagaaacaagaaaccgatatcgttcatatcaatgaacataaaaagatcacggaaaatattgtgcctggtcctaatggacaac |
248 |
Q |
| |
|
|||||||| |||||||||||||||| | || ||| |||| ||||||||| || ||||| ||||| ||||||||| |||||||| |
|
|
| T |
1022214 |
gaagaagacacaagaaaccgatatcatacacatcgatgagcataaaaagggcaaggaaaccattgtacctggtccttttggacaac |
1022129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University