View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7120_low_3 (Length: 407)
Name: NF7120_low_3
Description: NF7120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7120_low_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 341; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 341; E-Value: 0
Query Start/End: Original strand, 10 - 390
Target Start/End: Original strand, 18686759 - 18687139
Alignment:
| Q |
10 |
ttggtgttgggttgcatcttatttttggtcctattccgtcttggttctgctatgcttttgttggcctggcctggtggtaaactcagtctcgtttcggaac |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
18686759 |
ttggtgttgggttgcatcttatttttggtcctattccgtcttggttcttctatgcttttgttggcctggcctggtggtaaacttggtctcgtttcggaac |
18686858 |
T |
 |
| Q |
110 |
cagttccacttcaggttttggaggttagtccatatttttagggctgctctggttgtgcttttgggttttttctgggcccttgttagcttcagttatggtt |
209 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18686859 |
cagttccacttcagggtttggaggttagtccatatttttaggggcgctctggttgtgcttttgggttttttctgggcccttgttagcttcagttatggtt |
18686958 |
T |
 |
| Q |
210 |
gctgatgtgttgttattgcttttggtcgctggtttgcagttttgaaggacattttcccggttttagttttaactttgtacctgtatagttggagttgggg |
309 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
18686959 |
gctgatgtgttgttattgcttttggtcactggtttgcagttttgaaggacattttcccggttttagttttaactttgtacttgtatagttggagttgggg |
18687058 |
T |
 |
| Q |
310 |
gctatttgttgtgggagcaggtttagtgtagtttttgcttcatctgtttctgtttttctagagtatgccgctgctgtgttt |
390 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
18687059 |
gctatttgttgtgggagcaggtttagtgtagttttggcttcatctgtttctgtttttctagagtatgctgctgctgtgttt |
18687139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University