View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7120_low_4 (Length: 326)
Name: NF7120_low_4
Description: NF7120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7120_low_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 109; Significance: 8e-55; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 109; E-Value: 8e-55
Query Start/End: Original strand, 200 - 308
Target Start/End: Original strand, 35191171 - 35191279
Alignment:
| Q |
200 |
gtgatttttatgagaatttaatggaaattgaagaggtttaagcaatatgtacccagaaagaagaaacaacagatgggaaaatggaactgcaaacaaaccc |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35191171 |
gtgatttttatgagaatttaatggaaattgaagaggtttaagcaatatgtacccagaaagaagaaacaacagatgggaaaatggaactgcaaacaaaccc |
35191270 |
T |
 |
| Q |
300 |
taagcaagt |
308 |
Q |
| |
|
||||||||| |
|
|
| T |
35191271 |
taagcaagt |
35191279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University