View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7122_low_5 (Length: 388)
Name: NF7122_low_5
Description: NF7122
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7122_low_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 337; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 337; E-Value: 0
Query Start/End: Original strand, 19 - 371
Target Start/End: Original strand, 25840820 - 25841172
Alignment:
| Q |
19 |
agaggtaggatcatcatgtgtaatagaatttctccatggtggtgttccaccattacctctcaaatattttccacaccaacttctcagtttcacgttgaac |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
25840820 |
agaggtaggatcatcatgtgtaatagaatttctccatggtggtgttccaccattacctctcaaatattttccacaccaactcctcagtttcacgttgaac |
25840919 |
T |
 |
| Q |
119 |
ccttcttttattggttcccattcatatttccagcccaaacccgcgtcgtaatcggcttggacaactttgtttccggtcatgccgaggagaaatggcgtgt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25840920 |
ccttcttttattggttcccattcatatttccagcccaaacccgcgtcgtaatcggcttggacaactttgtttccggtcatgccgaggagaaatggcgtgt |
25841019 |
T |
 |
| Q |
219 |
ctgtcgcggttaggtaacggccgtggtggctcctgaggcgtatatggtgaggttttgtttcgaccggttcgattaaccatagtgattttttggttgttcc |
318 |
Q |
| |
|
| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
25841020 |
ccgtcgcggttaggtaacggccatggtggctcctgaggcgtatatggtgaggttttgtttcgaccggttcgataaaccatagtgattttttggttgttcc |
25841119 |
T |
 |
| Q |
319 |
atttctgctctgacggatgttgttgttgtcttcatctgctactaggtacttcc |
371 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25841120 |
atttctgctctgacggatgttgttgttgtcttcatctgctactaggtacttcc |
25841172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University