View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7122_low_8 (Length: 296)
Name: NF7122_low_8
Description: NF7122
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7122_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 16 - 287
Target Start/End: Original strand, 48014491 - 48014781
Alignment:
| Q |
16 |
cacaatgtaaccacaatgcatcgctctgagccgaattaggaccctctggctatccactcaacttttatattggattcatctcgtagtgaaagatatgttt |
115 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
48014491 |
cacaatgtaaccacaatgtatcgctctgagccgaattaggaccctctggctatccactcaacttttatattggattcatctcgtaatgaaatatatgttt |
48014590 |
T |
 |
| Q |
116 |
atcattcagttaaa------------------atcttccctagtttgagagtttgattccttgcattgcacctccatcgcatactttataaaatcactcc |
197 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
48014591 |
atcattcagttaaaatctccatactatataaaatcttccctagtttgagagtttgattccttgcattgcacctccatcgcatactttataaaaacactcc |
48014690 |
T |
 |
| Q |
198 |
tccggttaactaccattatcctccattgcacctcaacaactacatgtg-caccacgaggtcatctatggattagtcaataataagaataat |
287 |
Q |
| |
|
|||| | ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48014691 |
tccgatgaactaccattatcctccattgcacctcaacaactacatgtgtcaccacgaggtcatctatggattagtcaataataagaataat |
48014781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University