View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7123_high_2 (Length: 274)

Name: NF7123_high_2
Description: NF7123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7123_high_2
NF7123_high_2
[»] chr1 (2 HSPs)
chr1 (136-266)||(7150787-7150917)
chr1 (1-46)||(7150649-7150694)


Alignment Details
Target: chr1 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 136 - 266
Target Start/End: Original strand, 7150787 - 7150917
Alignment:
136 tttgtttgttcctctgcttagttttgtgtccgcatgggagagtgacacatatttacgactctttatcagatttgggtttgaactcggatctataactttt 235  Q
    |||||||||| |||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
7150787 tttgtttgtttctctgcttggttttgtatccgcatgggagagtgacacatatttacgactctttatcagatttgggtttgaactcagatctataactttt 7150886  T
236 taggttttagtttggttttggttatgatgtc 266  Q
    ||||||||| |||||||||||||||||||||    
7150887 taggttttaatttggttttggttatgatgtc 7150917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 7150649 - 7150694
Alignment:
1 ccgtggtgatctttttgtgggtgttttggttgtctgcactgaagag 46  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
7150649 ccgtggtgatctttttgtgggtgttttggttgtctgcactgaagag 7150694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University