View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7123_low_3 (Length: 274)
Name: NF7123_low_3
Description: NF7123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7123_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 136 - 266
Target Start/End: Original strand, 7150787 - 7150917
Alignment:
| Q |
136 |
tttgtttgttcctctgcttagttttgtgtccgcatgggagagtgacacatatttacgactctttatcagatttgggtttgaactcggatctataactttt |
235 |
Q |
| |
|
|||||||||| |||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
7150787 |
tttgtttgtttctctgcttggttttgtatccgcatgggagagtgacacatatttacgactctttatcagatttgggtttgaactcagatctataactttt |
7150886 |
T |
 |
| Q |
236 |
taggttttagtttggttttggttatgatgtc |
266 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |
|
|
| T |
7150887 |
taggttttaatttggttttggttatgatgtc |
7150917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 7150649 - 7150694
Alignment:
| Q |
1 |
ccgtggtgatctttttgtgggtgttttggttgtctgcactgaagag |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7150649 |
ccgtggtgatctttttgtgggtgttttggttgtctgcactgaagag |
7150694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University