View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7125_low_5 (Length: 291)
Name: NF7125_low_5
Description: NF7125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7125_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 99; Significance: 7e-49; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 99; E-Value: 7e-49
Query Start/End: Original strand, 154 - 272
Target Start/End: Complemental strand, 27344294 - 27344176
Alignment:
| Q |
154 |
acagaagataacaaatcagaagtagtctgcaaatgcaagcaaaatttctgcagttacttttataaagtgaaaatactatttcttcacattatattggatt |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||| |||| |||||||||||||||||||||| |
|
|
| T |
27344294 |
acagaagataacaaatcagaagtagtctgcaagtgcaagcaaaatttctgcagttacttttataaagcgaaattactctttcttcacattatattggatt |
27344195 |
T |
|
| Q |
254 |
tattcccaatcatggatca |
272 |
Q |
| |
|
|||||| |||||||||||| |
|
|
| T |
27344194 |
tattcctaatcatggatca |
27344176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 6 - 80
Target Start/End: Complemental strand, 27344431 - 27344357
Alignment:
| Q |
6 |
attgtgttctattaaaaatcaaatatttatttatttttcatcgtgcatgtttatgtttgcaatttgtttaatgac |
80 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
27344431 |
attgtgttctattaaaaatcaaatatttatttatttttcatcgtgcatgtttatgttttcaatttgtttaatgac |
27344357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University