View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7126_high_20 (Length: 307)
Name: NF7126_high_20
Description: NF7126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7126_high_20 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 83 - 225
Target Start/End: Original strand, 2576351 - 2576495
Alignment:
| Q |
83 |
ggtctgggacaatcgccctccttatcctgcctcata--cgtccatgttgtcgattttccagaaccatggtattttgacttgggttggagattgtcataag |
180 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2576351 |
ggtctgggacgatcgccctccttatcctgtctcatatacgtccatgttgtcaattttccagaaccatggtattttgacttgggttggagattgtcataag |
2576450 |
T |
|
| Q |
181 |
aaacattcaaataaaagtgcttgatctttattttcttgtctagtc |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2576451 |
aaacattcaaataaaagtgcttgatctttattttcttgtctagtc |
2576495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University