View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7126_high_26 (Length: 255)
Name: NF7126_high_26
Description: NF7126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7126_high_26 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 24 - 239
Target Start/End: Original strand, 7353030 - 7353245
Alignment:
| Q |
24 |
aaggttgctgggtcatttgtttctagtggtaggtgtgaagggaagatattccttaatgtcggtataatgtgcctgaagtttttcgcacaatatcaaagat |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7353030 |
aaggttgctgggtcatttgtttctagtggtaggtgtgaagggaagatattccttaatgtcggtataatgtgcctgaagtttttcgcacaatatcaaagat |
7353129 |
T |
|
| Q |
124 |
tggtccaaatatgggacataaatttttgggatgtcgagactgaattataaattgttatgttggttactaattatgtgtttaattattacctatgtgttta |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7353130 |
tggtccaaatatgggacataaatttttgggatgtcgagactgaattataaattgttatgttggttactaattatgtgtttaattattacctatgtgttta |
7353229 |
T |
|
| Q |
224 |
gcctaatgatgatatt |
239 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
7353230 |
gcctaatgatgatatt |
7353245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University