View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7126_high_29 (Length: 230)
Name: NF7126_high_29
Description: NF7126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7126_high_29 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 79; Significance: 4e-37; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 1 - 87
Target Start/End: Original strand, 55083690 - 55083776
Alignment:
| Q |
1 |
agttgagacttgagacaaagagcgcgggcgaaatccgggggtcgtgtctcagtctatgtggactgtctggtaaagtctacaatcttc |
87 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
55083690 |
agttgagacttgagacaaagagcgcgggcgaaatccgggggtcgtgtctcagtctatgtgaactgtctggtaaagtctacaaccttc |
55083776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 103 - 222
Target Start/End: Original strand, 55083802 - 55083909
Alignment:
| Q |
103 |
aaatgtcaaatcaatctcaagaatgaggaacttggtgcaactaagcagcatggactgggacatggaggatgatattgctgcaactacttcttggcaatcc |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
55083802 |
aaatgtcaaatcaatctcaagaatgaggaacttggtgcaactaagcagcatgga------------ggaggatattgctgcaactacttcttggcaatcc |
55083889 |
T |
|
| Q |
203 |
tctattttctacttcatctc |
222 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
55083890 |
tctattttctacttcatctc |
55083909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University