View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7126_low_17 (Length: 374)
Name: NF7126_low_17
Description: NF7126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7126_low_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 339; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 339; E-Value: 0
Query Start/End: Original strand, 8 - 358
Target Start/End: Original strand, 1036868 - 1037218
Alignment:
| Q |
8 |
tgaaatgaaatatatcaataagaaaccatgtcaattgaaatagatcatgccatttgcctatgctctacgcgaagaacgatacttgtaggaagcataaaca |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1036868 |
tgaaatgaaatatatcaataagaaaccatgtcaattgaaatagatcatgccatttgcctatgctctacgcgaagaacgatacttgtaggaagcataaaca |
1036967 |
T |
 |
| Q |
108 |
ccaagtgcaaccacaagaattgttgcaccagtgtatattagcttttgtttatcttcttcactgaacctctttgcataactggttacagcttgagtagtgg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1036968 |
ccaagtgcaaccacaagaattgttgcaccagtgtatattagcttttgtttatcttcttcactgaacctctttgcataactggttacagcttgagtagtgg |
1037067 |
T |
 |
| Q |
208 |
ataaagccatgtctttgattcttgtccttgttgattcaagaatctttttctcatcatgatcaccaaatttatcattaatcatttcctttcccttatcttt |
307 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
1037068 |
atagagccatgtctttgattcttgtccttgttgattcaagaatctttttctcatcatgatcaccaaatttatcattaatcatttcctttcccttctcttt |
1037167 |
T |
 |
| Q |
308 |
gtatgttttctttgaaggaaaagtttcaactgaggcagatcctttgctttc |
358 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
1037168 |
gtatgttttctttggaggaaaagtttcaactgaggcagatcctttgctttc |
1037218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University