View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7126_low_18 (Length: 346)
Name: NF7126_low_18
Description: NF7126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7126_low_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 96; Significance: 5e-47; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 96; E-Value: 5e-47
Query Start/End: Original strand, 19 - 114
Target Start/End: Complemental strand, 33990029 - 33989934
Alignment:
| Q |
19 |
ataataattatgtaatgcaactgtccttttctttgctgtcatctcttgtctcatttgtgatcggtgctttctacactttaatttgttttgtaactc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33990029 |
ataataattatgtaatgcaactgtccttttctttgctgtcatctcttgtctcatttgtgatcggtgctttctacactttaatttgttttgtaactc |
33989934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 240 - 329
Target Start/End: Complemental strand, 33989805 - 33989716
Alignment:
| Q |
240 |
ctttgcagcaacaaaagtaacacatacaacgatcacttgatttctcatgtaattggaggatttgtcaaatataaaaaggaatgtgaaaga |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
33989805 |
ctttgcagcaacaaaagtaacacatacaacaatcactggatttctcatgtaattggaggatttgtcaaatataaaaaggaatgtaaaaga |
33989716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 200 - 229
Target Start/End: Complemental strand, 33989848 - 33989819
Alignment:
| Q |
200 |
cgtgatttatgtttggataactttaaaata |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
33989848 |
cgtgatttatgtttggataactttaaaata |
33989819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 257 - 329
Target Start/End: Complemental strand, 45822576 - 45822501
Alignment:
| Q |
257 |
taacacatacaacgatcacttgatttctcatgtaattggaggat---ttgtcaaatataaaaaggaatgtgaaaga |
329 |
Q |
| |
|
||||||||||||| |||| |||||| ||||||||||||||||| |||||||||||||| || ||| ||||||| |
|
|
| T |
45822576 |
taacacatacaacaatcaactgatttgtcatgtaattggaggattaattgtcaaatataaacagaaatttgaaaga |
45822501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University