View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7126_low_18 (Length: 346)

Name: NF7126_low_18
Description: NF7126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7126_low_18
NF7126_low_18
[»] chr3 (3 HSPs)
chr3 (19-114)||(33989934-33990029)
chr3 (240-329)||(33989716-33989805)
chr3 (200-229)||(33989819-33989848)
[»] chr7 (1 HSPs)
chr7 (257-329)||(45822501-45822576)


Alignment Details
Target: chr3 (Bit Score: 96; Significance: 5e-47; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 96; E-Value: 5e-47
Query Start/End: Original strand, 19 - 114
Target Start/End: Complemental strand, 33990029 - 33989934
Alignment:
19 ataataattatgtaatgcaactgtccttttctttgctgtcatctcttgtctcatttgtgatcggtgctttctacactttaatttgttttgtaactc 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33990029 ataataattatgtaatgcaactgtccttttctttgctgtcatctcttgtctcatttgtgatcggtgctttctacactttaatttgttttgtaactc 33989934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 240 - 329
Target Start/End: Complemental strand, 33989805 - 33989716
Alignment:
240 ctttgcagcaacaaaagtaacacatacaacgatcacttgatttctcatgtaattggaggatttgtcaaatataaaaaggaatgtgaaaga 329  Q
    |||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||    
33989805 ctttgcagcaacaaaagtaacacatacaacaatcactggatttctcatgtaattggaggatttgtcaaatataaaaaggaatgtaaaaga 33989716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 200 - 229
Target Start/End: Complemental strand, 33989848 - 33989819
Alignment:
200 cgtgatttatgtttggataactttaaaata 229  Q
    ||||||||||||||||||||||||||||||    
33989848 cgtgatttatgtttggataactttaaaata 33989819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 257 - 329
Target Start/End: Complemental strand, 45822576 - 45822501
Alignment:
257 taacacatacaacgatcacttgatttctcatgtaattggaggat---ttgtcaaatataaaaaggaatgtgaaaga 329  Q
    ||||||||||||| ||||  |||||| |||||||||||||||||   |||||||||||||| || ||| |||||||    
45822576 taacacatacaacaatcaactgatttgtcatgtaattggaggattaattgtcaaatataaacagaaatttgaaaga 45822501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University