View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7126_low_24 (Length: 270)
Name: NF7126_low_24
Description: NF7126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7126_low_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 22 - 253
Target Start/End: Original strand, 28829558 - 28829789
Alignment:
| Q |
22 |
atatccgaccagcattagctttccaacccggttcggttcatcggtcaccggcggtgacggcccaaccgccccgtgttgggccgatcgccgttggtgttaa |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28829558 |
atatccgaccagcattagctttccaacccggttcggttcatcggtcaccagcggtgacggcccaaccgccccgtgttgggccgatcgccgttggtgttaa |
28829657 |
T |
 |
| Q |
122 |
gctagtccagcaagaaggtgtagcagcacttttctccggtgtctctgccaccgttctccggcagtgtctctattccaccactcgtatgggactctatgat |
221 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28829658 |
gctagtccaacaagaaggtgtagcagcacttttctccggtgtctctgccaccgttctccggcagtgtctctattccaccactcgtatgggactctatgat |
28829757 |
T |
 |
| Q |
222 |
atgatgaagaaaaaatggtctgatcctatctc |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
28829758 |
atgatgaagaaaaaatggtctgatcctatctc |
28829789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University