View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7126_low_28 (Length: 256)
Name: NF7126_low_28
Description: NF7126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7126_low_28 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 19 - 241
Target Start/End: Original strand, 2625086 - 2625308
Alignment:
| Q |
19 |
aataccattggatagcagcttgacttaagtttggatgactactcattggaatttgcatcatgcaaatttgggttttgattaattattgagctttcagtgt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2625086 |
aataccattggatagcagcttgacttaagtttggatgactactcgttggaatttgcatcatgcaaatttgggttttgattaattattgagctttcagtgg |
2625185 |
T |
|
| Q |
119 |
agatcgtataagcactgaagaactttccagtagattagttgagtttggattgattggttccatttgaatatttgatgtaataccaatgtgttttcaaatt |
218 |
Q |
| |
|
||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2625186 |
agatcatataagcagtgaagaactttccagtagattagttgagtttggattgattggttccatttgaatatttgatgtaataccaatgtgttttcaaatt |
2625285 |
T |
|
| Q |
219 |
ttatgtattttatgagtgatgtc |
241 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
2625286 |
ttatgtattttatgagtgatgtc |
2625308 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University