View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7127_low_2 (Length: 487)
Name: NF7127_low_2
Description: NF7127
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7127_low_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 256; Significance: 1e-142; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 203 - 474
Target Start/End: Complemental strand, 52518952 - 52518681
Alignment:
| Q |
203 |
ctaagggctgaatatattaagttttgaatggcatcaatatcttgttttagtaagagtccattgcccatgaaagagacagctttgagccatggtgaatatc |
302 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52518952 |
ctaagggctgaatatattaagttgtgaatggcatcaacatcttgttttagtaagagtccattacccatgaaagagacagctttgagccatggtgaatatc |
52518853 |
T |
 |
| Q |
303 |
ctccacctatggcaacttatgaggaggttgtagacaatcccaagctcttcatactttgcttggagaagctccacactctaatgggcaccaagttcatgta |
402 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52518852 |
ctccacctatggcaacttatgaggaggttgtagacaatcccaagctcttcatactttgcttggagaagctccacactctaatgggcaccaagttcatgta |
52518753 |
T |
 |
| Q |
403 |
agctccctggatttataaactacaaactagagattgtgacttggtttacttttatattaagatgtggaaaat |
474 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52518752 |
agctccctggatttataaactacgaactagagattgtgacttggtttacttttatattaagatgtggaaaat |
52518681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 10 - 50
Target Start/End: Complemental strand, 52519140 - 52519100
Alignment:
| Q |
10 |
attattctcattaatgtttttgttttccctatctacaaata |
50 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52519140 |
attattctcattaatgtttttgttttccctatctacaaata |
52519100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University