View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7128_high_1 (Length: 279)
Name: NF7128_high_1
Description: NF7128
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7128_high_1 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 64 - 257
Target Start/End: Complemental strand, 38496854 - 38496661
Alignment:
| Q |
64 |
tgatgtcccaaattattgaccaccacttatttgaggaggagaatcagatttccacacaaatggggttcattcctttcccaacaaaccttactttcccttc |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38496854 |
tgatgtcccaaattattgaccaccacttatttgaggaggagaatcagatttccacacaaatggggttcattcctttcccaacaaaccttactttcccttc |
38496755 |
T |
|
| Q |
164 |
tttagattgcaatcaatctttgaaagccttcagttccatagcttcttcacttacatctgaatcagattctacatcaaacctaacacaaacccta |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38496754 |
tttagattgcaatcaatctttgaaagccttcagttccatagcttcttcacttacatctgaatcagattctacatcaaacctaacacaaacccta |
38496661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University