View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7128_high_6 (Length: 213)

Name: NF7128_high_6
Description: NF7128
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7128_high_6
NF7128_high_6
[»] chr3 (1 HSPs)
chr3 (13-198)||(47894150-47894353)


Alignment Details
Target: chr3 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 13 - 198
Target Start/End: Original strand, 47894150 - 47894353
Alignment:
13 aagaatatctcgatacggtgtcccaccggtgaacgtgagggaattagttggcttcatgaggagtgttagggttgatgaatggagtccggtgtctaagatg 112  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47894150 aagaaaatctcgatacggtgtcccaccggtgaacgtgagggaattagttggcttcatgaggagtgttagggttgatgaatggagtccggtgtctaagatg 47894249  T
113 ggttct------------------ccacgaggtggttttttgagtcttccatcaaactatgaaggggttggtatggagagggtggaatcaggaagagatc 194  Q
    ||||||                  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47894250 ggttctgtgtttggttctccacgaccacgaggtggttttttgagtcttccatcaaactatgaaggggttggtatggagagggtggaatcaggaagagatc 47894349  T
195 ttag 198  Q
    ||||    
47894350 ttag 47894353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University