View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7128_low_2 (Length: 249)
Name: NF7128_low_2
Description: NF7128
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7128_low_2 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 13 - 249
Target Start/End: Complemental strand, 37625460 - 37625223
Alignment:
| Q |
13 |
aatattcgtggataactttgaacgaaacacacactctaaggtcagagtcatagttattt-tannnnnnnngaaagaagagtcattgttattataagtata |
111 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| |||||||| ||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
37625460 |
aatattcgtggataactttgaaccaaacacacactctaaggttagagtcattgttatttatttattttttgaaagaagagtcattgttattataagtata |
37625361 |
T |
|
| Q |
112 |
ttttttaccaaatagaaattattatattttttgactaaaccaaatatagaaattataaatatttttggtggtgaagcctctctcattgcatgaggacaat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37625360 |
ttttttaccaaatagaaattattatattttttgactaaaccaaatatagaaattataaatatttttggtggtgaagcctctctcattgcatgaggacaat |
37625261 |
T |
|
| Q |
212 |
taattatattgtcgctgttggagaacttgccaatgaga |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37625260 |
taattatattgtcgctgttggagaacttgccaatgaga |
37625223 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University