View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7128_low_3 (Length: 245)
Name: NF7128_low_3
Description: NF7128
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7128_low_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 37624981 - 37624751
Alignment:
| Q |
1 |
attatggtcaattaagatcatgattgtttaattatttcctaaaatgatagtcacataaaaaa-tgctaataaaatgatgccaatgatattctaataggtg |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37624981 |
attatggtcaattaagatcatgattgtttaattatttcctaaaatgatagtcacataaaaaaatgctaataaaatgatgccaatgatattctaataggtg |
37624882 |
T |
 |
| Q |
100 |
gtaggtgctaaaattgcatacatgatatatttaccaatgacaccaatagatagactcaaatagttatagttgttggtcccatattgcgttgcacttgaaa |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37624881 |
gtaggtgctaaaattgcatacatgatatatttaccaatgacaccaatagatagactcaaatagttatagttgttggtcccatattgcgttgcacttgaaa |
37624782 |
T |
 |
| Q |
200 |
ggaacttttaacatgcatgtaccattgtttc |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
37624781 |
ggaacttttaacatgcatgtaccattgtttc |
37624751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University