View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7128_low_6 (Length: 213)
Name: NF7128_low_6
Description: NF7128
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7128_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 13 - 198
Target Start/End: Original strand, 47894150 - 47894353
Alignment:
| Q |
13 |
aagaatatctcgatacggtgtcccaccggtgaacgtgagggaattagttggcttcatgaggagtgttagggttgatgaatggagtccggtgtctaagatg |
112 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47894150 |
aagaaaatctcgatacggtgtcccaccggtgaacgtgagggaattagttggcttcatgaggagtgttagggttgatgaatggagtccggtgtctaagatg |
47894249 |
T |
 |
| Q |
113 |
ggttct------------------ccacgaggtggttttttgagtcttccatcaaactatgaaggggttggtatggagagggtggaatcaggaagagatc |
194 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47894250 |
ggttctgtgtttggttctccacgaccacgaggtggttttttgagtcttccatcaaactatgaaggggttggtatggagagggtggaatcaggaagagatc |
47894349 |
T |
 |
| Q |
195 |
ttag |
198 |
Q |
| |
|
|||| |
|
|
| T |
47894350 |
ttag |
47894353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University