View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7131_low_2 (Length: 342)
Name: NF7131_low_2
Description: NF7131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7131_low_2 |
 | |
|
| [»] scaffold0405 (1 HSPs) |
| | |
|
Alignment Details
Target: chr5 (Bit Score: 89; Significance: 7e-43; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 89; E-Value: 7e-43
Query Start/End: Original strand, 98 - 190
Target Start/End: Complemental strand, 9694883 - 9694791
Alignment:
| Q |
98 |
caaatctcgaagtcggaagaagaatctcaccggttatcagcaggtttggcatcggaaacagctttcggcatggtgaaacggtgattgaacttc |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9694883 |
caaatctcgaagtcggaagaagaatctcaccggttatcagcaggtttggcgtcggaaacagctttcggcatggtgaaacggtgattgaacttc |
9694791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 272 - 332
Target Start/End: Complemental strand, 9694709 - 9694649
Alignment:
| Q |
272 |
cgtgagtgggtttttgtattgagaaggataaagagggaaattgaaaattgaagcacaggtt |
332 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
9694709 |
cgtgagtgggtttttgtattgagaaggataaagagggaaattgaaaattgaagcacgggtt |
9694649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 30
Target Start/End: Complemental strand, 9694980 - 9694951
Alignment:
| Q |
1 |
ccagtacctgcgcccttgcgcttcaaccta |
30 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
9694980 |
ccagtacctgcgcccttgcgcttcaaccta |
9694951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0405 (Bit Score: 44; Significance: 5e-16; HSPs: 1)
Name: scaffold0405
Description:
Target: scaffold0405; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 125 - 190
Target Start/End: Original strand, 15561 - 15630
Alignment:
| Q |
125 |
caccggttatcagcaggtttggcatcg-gaaacagctttcggcatggtgaaac---ggtgattgaacttc |
190 |
Q |
| |
|
|||| |||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
15561 |
caccagttatcagcaggtttggcatcgagaaacagctttcggcatggtgaaacgctggtgattgaacttc |
15630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University