View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7131_low_3 (Length: 262)
Name: NF7131_low_3
Description: NF7131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7131_low_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 208; Significance: 1e-114; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 19 - 250
Target Start/End: Original strand, 34880299 - 34880530
Alignment:
| Q |
19 |
gtagactcatattaaccaccctaacatctttcgccccaaacccctctaacttcttggttggcaaaccttcctccatttgacccaacaatttttgtgactt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34880299 |
gtagactcatattaaccaccctaacatctttcgccccaaacccctctaacttcttggttggcaaaccttcctccatttgacccaacaatttttgtgactt |
34880398 |
T |
 |
| Q |
119 |
ccttttgtgaaaattgacttccgaacctagcatcatttcgaatcctctcaataatgctttcaatgtccaaaattatccaccattggctcccatatacata |
218 |
Q |
| |
|
|||||||||||||||||||||||| ||| || ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34880399 |
ccttttgtgaaaattgacttccgaccctgacaccatttggaatcctctcaataatgctttcaatgtccaaaattatccaccattggctcccatatacata |
34880498 |
T |
 |
| Q |
219 |
gagtatcatcgacgtattgcaaatgccatatt |
250 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |
|
|
| T |
34880499 |
gagtatcatcgacgtattgcaaatgcgatatt |
34880530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 69 - 106
Target Start/End: Complemental strand, 36988012 - 36987975
Alignment:
| Q |
69 |
ttcttggttggcaaaccttcctccatttgacccaacaa |
106 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
36988012 |
ttctaggttggcaaaccttcctccatttcacccaacaa |
36987975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University