View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7132_high_3 (Length: 249)
Name: NF7132_high_3
Description: NF7132
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7132_high_3 |
 | |
|
| [»] scaffold0209 (2 HSPs) |
| | |
|
Alignment Details
Target: chr5 (Bit Score: 119; Significance: 7e-61; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 14417385 - 14417123
Alignment:
| Q |
1 |
tatgagtggatgcaataataaactttatgatttgaggannnnnnnnnngttgtcaattgcttagaccgatgttgatgggaattgagttcttgactatgga |
100 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| | |||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
14417385 |
tatgagtggatgcaataataaactttgtgatttgag-aatttttttttgttgtcaattgcttagacggatgttgatgggaattgagttcttgactatgga |
14417287 |
T |
|
| Q |
101 |
gtgtttgtagctatgacaattcacttgcaaagaatggtgaatgacgagcattaccacaaagcattcaannnnnnngcactta------------------ |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
14417286 |
gtgtttgtagctatgacaattcacttgcaaagaatggtgaatgacgagcattaccgcaaagcattcaagttttttgcacttatgtgcatagcttgcactt |
14417187 |
T |
|
| Q |
183 |
-tggttgctgcaagttcacgggagatgaactcttctagagggatggtcagagattcatttcagt |
245 |
Q |
| |
|
||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
14417186 |
atggttgctgcaagttcaggggagatgagctcttctagagggatggtcagagattcattgcagt |
14417123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 176 - 223
Target Start/End: Original strand, 30654775 - 30654822
Alignment:
| Q |
176 |
gcacttatggttgctgcaagttcacgggagatgaactcttctagaggg |
223 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||| || |||||||||| |
|
|
| T |
30654775 |
gcacttatggttgctgcaagctcaggggagatgagcttttctagaggg |
30654822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 51 - 168
Target Start/End: Original strand, 44512662 - 44512779
Alignment:
| Q |
51 |
tgtcaattgcttagaccgatgttgatgggaattgagttcttgactatggagtgtttgtagctatgacaattcacttgcaaagaatggtgaatgacgagca |
150 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |||||||||||||||||| |||||||||| |||||||||||||||||||||||| |||||||||||| |
|
|
| T |
44512662 |
tgtcaattgcttaggccgatgttgatgggaatggagttcttgactatggagagtttgtagctgtgacaattcacttgcaaagaatggagaatgacgagca |
44512761 |
T |
|
| Q |
151 |
ttaccacaaagcattcaa |
168 |
Q |
| |
|
|| || ||||||||||| |
|
|
| T |
44512762 |
tttccgtaaagcattcaa |
44512779 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 51 - 152
Target Start/End: Original strand, 7912996 - 7913097
Alignment:
| Q |
51 |
tgtcaattgcttagaccgatgttgatgggaattgagttcttgactatggagtgtttgtagctatgacaattcacttgcaaagaatggtgaatgacgagca |
150 |
Q |
| |
|
|||||||| ||||| | ||||| |||||||| ||||||||| ||||||| |||||||||| |||||||||||||||||| ||||| ||||||||| || |
|
|
| T |
7912996 |
tgtcaatttcttaggctaatgttcatgggaatgtagttcttgattatggagagtttgtagctgtgacaattcacttgcaaaaaatggagaatgacgacca |
7913095 |
T |
|
| Q |
151 |
tt |
152 |
Q |
| |
|
|| |
|
|
| T |
7913096 |
tt |
7913097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 47; Significance: 6e-18; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 238
Target Start/End: Complemental strand, 25035586 - 25035524
Alignment:
| Q |
176 |
gcacttatggttgctgcaagttcacgggagatgaactcttctagagggatggtcagagattca |
238 |
Q |
| |
|
|||||| ||||||||||||||||| || |||||| |||||||||||||||||||||||||||| |
|
|
| T |
25035586 |
gcacttgtggttgctgcaagttcaaggaagatgagctcttctagagggatggtcagagattca |
25035524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 49 - 107
Target Start/End: Complemental strand, 25035644 - 25035586
Alignment:
| Q |
49 |
gttgtcaattgcttagaccgatgttgatgggaattgagttcttgactatggagtgtttg |
107 |
Q |
| |
|
|||||||||||||||| |||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
25035644 |
gttgtcaattgcttaggttgatgttgatgtgaatggagttcttgactatggagtgtttg |
25035586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0209 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: scaffold0209
Description:
Target: scaffold0209; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 176 - 237
Target Start/End: Original strand, 7464 - 7525
Alignment:
| Q |
176 |
gcacttatggttgctgcaagttcacgggagatgaactcttctagagggatggtcagagattc |
237 |
Q |
| |
|
|||||||||||||||||||||||| |||||| | ||||||| |||| ||||||||||||| |
|
|
| T |
7464 |
gcacttatggttgctgcaagttcaagggagacgtgctcttctctagggctggtcagagattc |
7525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0209; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 176 - 237
Target Start/End: Original strand, 20918 - 20979
Alignment:
| Q |
176 |
gcacttatggttgctgcaagttcacgggagatgaactcttctagagggatggtcagagattc |
237 |
Q |
| |
|
|||||||||||||||||||||||| |||||| | ||||||| |||| ||||||||||||| |
|
|
| T |
20918 |
gcacttatggttgctgcaagttcaagggagacgtgctcttctctagggctggtcagagattc |
20979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 176 - 237
Target Start/End: Complemental strand, 8834318 - 8834257
Alignment:
| Q |
176 |
gcacttatggttgctgcaagttcacgggagatgaactcttctagagggatggtcagagattc |
237 |
Q |
| |
|
|||||||||||||||||||||| | |||||||| |||||| | |||| ||||||||||||| |
|
|
| T |
8834318 |
gcacttatggttgctgcaagtttaggggagatgcactcttttgtagggctggtcagagattc |
8834257 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University