View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7132_high_5 (Length: 228)
Name: NF7132_high_5
Description: NF7132
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7132_high_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 209
Target Start/End: Original strand, 32014028 - 32014236
Alignment:
| Q |
1 |
taattatgagtgatattcgttgtccaaataattgggaggattagaagggattttgtctcctggaagagcaatatcaaaagtgtgtcgtgggtgggtaatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
32014028 |
taattatgagtgatattcgttgtccaaataattgggaggattagaagggattgtgtctcctggaagagcaatataaaaagtgtgtcgtgggtgggtaatg |
32014127 |
T |
|
| Q |
101 |
ttcaaacacaaccttacaacaattcagactttcatacaaaaaataaaatcctaacattcccacattcatcatcctttttgtcatttctcttggtgtccta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
32014128 |
ttcaaacacaaccttacaacaattcagactctcatacaaaaaataaaatcctaacattcccatattcatcatcctttttgtcatttctctcggtgtccta |
32014227 |
T |
|
| Q |
201 |
tgtgcttta |
209 |
Q |
| |
|
||||||||| |
|
|
| T |
32014228 |
tgtgcttta |
32014236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 164 - 200
Target Start/End: Original strand, 32014384 - 32014420
Alignment:
| Q |
164 |
attcatcatcctttttgtcatttctcttggtgtccta |
200 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
32014384 |
attcatcatactttatgtcatttctcttggtgtccta |
32014420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University