View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7132_low_2 (Length: 369)
Name: NF7132_low_2
Description: NF7132
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7132_low_2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 16 - 351
Target Start/End: Complemental strand, 39504589 - 39504254
Alignment:
| Q |
16 |
atcttcactgtcctccaccataccatagtcaacgccgccgccctcgttcctggcgcctccgtctttccctccgccaccttcgattctgtcaacaacaaac |
115 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||| |||||||||| | |
|
|
| T |
39504589 |
atcttcaccgtcctccaccataccatagtcaacgccgccgccctcgttcctggcgtctccgtcttcccctccgccaccttcgattctttcaacaacaacc |
39504490 |
T |
|
| Q |
116 |
ccctcgccgtcgtggaagattccaattgcgaaattgtggagctcgacgccatggaattgctagctgaacatctccacttttgcgagatatgcggcaaagg |
215 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39504489 |
ccctcgccgccgtggaagattccgattgcgaaattgtggagctcgacgccatggaattgctagctgaacatctccacttttgcgagatatgcggcaaagg |
39504390 |
T |
|
| Q |
216 |
cttcaagcgcgacgcgaatctccggatgcacatgagagctcacgggaatcaattcaagacgccggaagctttagcgaagcctttaaacatgctccgtcgt |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
39504389 |
cttcaagcgcgacgcgaatctccggatgcacatgagagctcacgggaatcaattcaagacgccggaagctttagcgaagcctttaaacatggtccgtcgt |
39504290 |
T |
|
| Q |
316 |
ccaacgcaattctcgtgtccgtttgaaggatgtaac |
351 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
39504289 |
ccaacgcaattctcgtgtccgtttgaaggatgtaac |
39504254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University