View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7133_low_2 (Length: 261)
Name: NF7133_low_2
Description: NF7133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7133_low_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 36463554 - 36463797
Alignment:
| Q |
1 |
ccgaaccatcataaccgccaaccctctgaacgttgaatacattctcaaaaccaatttcactaacttccctaaaggaaaacccttcactgaaattctaagt |
100 |
Q |
| |
|
||||||||||||||||||||| ||||| || ||||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| |||||||| ||| |
|
|
| T |
36463554 |
ccgaaccatcataaccgccaatcctctcaatgttgaatacatcctcaaaaccaatttcaccaacttccctaaaggtaaacccttcacagaaattctcagt |
36463653 |
T |
 |
| Q |
101 |
gaccttttaggttgcggcatattcaatgcggatggaaagttgtggtcaaagcagcgtaaaataggcagccacgaattcacaacaaggtctctcaaagact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| |||||||| || ||||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
36463654 |
gaccttttaggttgcggcatattcaatgtagatggaaagttatggtcaaaacaacgtaaaataggtagccatgaattcacaacaaggtctctcaaagact |
36463753 |
T |
 |
| Q |
201 |
ttgttgcaaagacacttgaagatgaagttcaacaaagacttatt |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36463754 |
ttgttgcaaagacacttgaagatgaagttcaacaaagacttatt |
36463797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University