View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7134_high_10 (Length: 379)
Name: NF7134_high_10
Description: NF7134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7134_high_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 354; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 354; E-Value: 0
Query Start/End: Original strand, 1 - 374
Target Start/End: Complemental strand, 3273018 - 3272645
Alignment:
| Q |
1 |
gtctaactctacagcggaattctgatacgagcattggctaatgtctcacacaaaacacatggattatctgctccacaaatcgccttcaatgttgttggct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
3273018 |
gtctaactctacagcggaattctgatacgggcattggctaatgtctcacacaaaacacatggattatctgctccacaaattgccttcaatgttgttggct |
3272919 |
T |
 |
| Q |
101 |
tctgcatagctgtagctacaacaatatttttcacaatctatgctaagaggcggctcaacgagttgcgacaagaggaagaactgcagtcattgatataatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3272918 |
tctgcatagctgtagctacaacaatatttttcacaatctatgctaagaggcggctcaacgagttgcgacaagaggaagaactgcagtcattgatataatc |
3272819 |
T |
 |
| Q |
201 |
agtatggctcatagtatattgattgatgcatactgcaaaattggatgagatattactacttgagtaacataagaggtgtggaaagggttactgagcaaga |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3272818 |
agtatggctcatagtatattgattgatgcatactgcaaaattggatgagatcttactacttgagtaacataagaggtgtggaaagggttactgaacaaga |
3272719 |
T |
 |
| Q |
301 |
ttacacaacaaatttttcttcttccttttgttgtctacaatgacactcttcttttttggtcctttcatatcact |
374 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
3272718 |
ttacacaacaaatttttcttcttccttttgttgtctacaatgacactcttcttttttggtccttccatatcact |
3272645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University