View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7134_high_12 (Length: 337)
Name: NF7134_high_12
Description: NF7134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7134_high_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 85 - 332
Target Start/End: Complemental strand, 31257447 - 31257190
Alignment:
| Q |
85 |
atgtaacaagctttaagcatgttcgttcaatttcacaaaattttgaacccagaatcattacacagtgacatatgtgacaaattttaaacgcatgaatgca |
184 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
31257447 |
atgtaacatactttaagcatgttggttcaatttcacaaaattttgaacccagattcattacacaatgacatatgtgacaaattttcaacgcatgaatgca |
31257348 |
T |
 |
| Q |
185 |
atgtcacaaatttttgagctcacgttcatggatttgagagagagg----------ggggatatcaagtgagagatagacataacttgatgaaggagggag |
274 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31257347 |
atgtcacaaatttatgagctcacgttcatggatttgagagagaggggggggggggggggatatcaagtgagagatagacataacttgatgaaggagggag |
31257248 |
T |
 |
| Q |
275 |
aaagagacaacgaggggaaaggagaggatccaatctcgatttgcatattcatctcact |
332 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
31257247 |
aaagagacaatgaggggaaaggagaggatccaatctcgatttgcacattcatctcact |
31257190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University