View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7134_low_19 (Length: 284)
Name: NF7134_low_19
Description: NF7134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7134_low_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 22 - 279
Target Start/End: Original strand, 41592982 - 41593239
Alignment:
| Q |
22 |
gagaatttatgcaaaattctctttgctcacgccatggttcttactgtaagtggagaggctatttctaaataaatggtttatgcaatataatttcttttgt |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41592982 |
gagaatttatgcaaaattctctttgctcacgccatggttcttaccgtaagtggagaggctatttctaaataaatggtttatgcaatataatttcttttgt |
41593081 |
T |
 |
| Q |
122 |
cctttcaaaaaatataatttgttttgtgtcaattttgctttcgttcatgtgcattttaattgtctttaagtgatttgcagaagtttttccattggttgat |
221 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
41593082 |
cctttcaaaaaatataatttgttttatgtcaattttgctttcgttcatgtgcattttaattgtctttaagtgatttgcagaagtttttccgttggttgat |
41593181 |
T |
 |
| Q |
222 |
gattgtgattcaattttatttttatcttttgcacttagtttgatggagaataatgtag |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
41593182 |
gattgtgattcaattttatttttatcttttgcacttagtttgatggagaattatgtag |
41593239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University