View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7134_low_22 (Length: 259)
Name: NF7134_low_22
Description: NF7134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7134_low_22 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 247
Target Start/End: Complemental strand, 33860119 - 33859876
Alignment:
| Q |
1 |
agatcactgagtcagcattgatgaattgaatcgtgcaggatgatgatatggatgtatttgtggaaaaacaatatcagaagaggaagaagacctatgattc |
100 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||| |||||| |
|
|
| T |
33860119 |
agatcactgagtcagcattgatgaatggaatcgtgcaggatgatgatatggatgtatttgtggaaaaacaacatcagaagaggaaga---cctttgattc |
33860023 |
T |
|
| Q |
101 |
tgctgtttagtattagttatgctgattagtataacagaaattttaaatttgaatttcagtattgctaggaacagattttacctattaagtaggattaatt |
200 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33860022 |
tgctgtttaggattagttatgctgattagtataatagaatttttaaatttgaatttcagtattgctaggaacagattttacctattaagtaggattaatt |
33859923 |
T |
|
| Q |
201 |
gttaggaagacctttgaatttctctctaggtgttctgtgtgatgtcc |
247 |
Q |
| |
|
||| |||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
33859922 |
gttgggaagacctttgaatttctctctaggagttctgtgtgatgtcc |
33859876 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000006; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 129 - 188
Target Start/End: Complemental strand, 32867656 - 32867597
Alignment:
| Q |
129 |
gtataacagaaattttaaatttgaatttcagtattgctaggaacagattttacctattaa |
188 |
Q |
| |
|
||||||||||| ||||||| || |||| |||||||| | |||||||||||||||||||| |
|
|
| T |
32867656 |
gtataacagaatttttaaacttaaattacagtattgttgagaacagattttacctattaa |
32867597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 44 - 102
Target Start/End: Complemental strand, 32867753 - 32867697
Alignment:
| Q |
44 |
tgatatggatgtatttgtggaaaaacaatatcagaagaggaagaagacctatgattctg |
102 |
Q |
| |
|
||||| ||||| |||||||| ||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
32867753 |
tgatacggatgcatttgtgggaaaacaatatcagaagagg--gaagacctttgattctg |
32867697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University